Skip to content

broadinstitute/pyfrost

Pyfrost

A Python library for creating and analyzing compacted colored de Bruijn Graphs powered by Bifrost with a NetworkX compatible API.

This library is still in an early development stage, and the API is still subject to change. Furthermore, not all functions from NetworkX are implemented yet.

Requirements

  • Python >= 3.6
  • C++14 compatible compiler (GCC >5, Clang >3.4)
  • CMake >= 3.10

Installation

Use the source tarball from Github to install the library:

pip install https://github.com/broadinstitute/pyfrost/releases/download/v0.1.0b1/pyfrost-0.1.0b1.tar.gz

PIP and Conda packages will be coming soon.

Usage

Building and loading graphs

Build a graph from a list of references:

import pyfrost
g = pyfrost.build_from_refs(['data/ref1.fa', 'data/ref2.fa'])

Build a graph from reads:

g = pyfrost.build_from_samples([
    'data/sample1.1.fq.gz', 'data/sample1.2.fq.gz',
    'data/sample2.1.fq.gz', 'data/sample2.2.fq.gz'
])

Build a graph from both references and reads:

g = pyfrost.build(
    ['data/ref1.fa', 'data/ref2.fa'],
    ['data/sample1.1.fq.gz', 'data/sample1.2.fq.gz']
)

All calls above also accept optional parameters k and g for the k-mer and minimizer size respectively.

Loading a colored graph created earlier with Bifrost:

g = pyfrost.load('graph.gfa')

Access some graph metadata:

>>> g.graph
{'k': 31, 'color_names': ['data/ref1.fa', 'data.ref2.fa']}

You can set custom metadata too:

>>> g.graph['custom_attr'] = "test"

Access unitigs and k-mers

Iterate over all unitigs (nodes) in the graph. Nodes are keyed by the first k-mer of the unitig.

>>> list(g.nodes)
[<Kmer 'TCGAA'>,
 <Kmer 'CCACG'>,
 <Kmer 'CGATG'>,
 <Kmer 'ATGCG'>,
 <Kmer 'GTGGC'>,
 <Kmer 'ATCGA'>]

>>> len(g.nodes)
6

Access unitig sequence and node metadata

>>> str(g.nodes["TCGAA"])
TCGAAATCAGT

>>> g.nodes["TCGAA"]['unitig_sequence']
TCGAAATCAGT

>>> g.nodes["TCGAA"]['head']
<Kmer 'TCGAA'>

>>> g.nodes["TCGAA"]['tail']
<Kmer 'TCAGT'>

>>> g.nodes["TCGAA"]['strand']
Strand.FORWARD

>>> for k, v in g.nodes['TCGAA'].items():
   ...:     print(k, "-", v)
   ...:
colors - <pyfrostcpp.UnitigColors object at 0x10d79d5b0>
unitig_sequence - TCGAAATCAGT
tail - TCAGT
length - 7
strand - Strand.FORWARD
mapped_sequence - TCGAAATCAGT
pos - 0
is_full_mapping - True
unitig_length - 7
head - TCGAA

length and unitig_length are in terms of number of k-mers, not nucleotides. Mapped sequence and length will be discussed later.

Iterate over nodes and its neighbors:

>>> for n, neighbors in g.adj.items():
   ...:     print("Current node:", str(g.nodes[n]))
   ...:     for nbr in neighbors:
   ...:         print("-", str(nbr))
   ...:
Current node: TCGAAATCAGT
Current node: CCACGGTGG
- GTGGC
Current node: CGATGC
- ATGCC
- ATGCG
Current node: ATGCGAT
- CGATG
Current node: GTGGCAT
- GCATC
Current node: ATCGA
- TCGAA
- TCGAT

Find a specific k-mer (not necessarily the head of a unitig):

>>> mapping = g.find('AAATC')
>>> for k, v in mapping.items():
    ...:     print(k, "-", v)
    ...:
colors - <pyfrostcpp.UnitigColors object at 0x10d79d1b0>
unitig_sequence - TCGAAATCAGT
tail - TCAGT
length - 1
strand - Strand.FORWARD
mapped_sequence - AAATC
pos - 3
is_full_mapping - False
unitig_length - 7
head - TCGAA

As you can see, this k-mer is located on the same unitig used in an earlier example. The metadata, however, now shows different values for mapped_sequence and length, and is_full_mapping is now False, because this k-mer doesn't represent a whole unitig. head and tail still refer to the head and tail k-mer of the whole unitig.

Access unitig colors

Bifrost builds colored compacted De Bruijn graphs, and keeps track which k-mers are observed in which references /samples. To obtain which colors are associated with a unitig or a k-mer, access 'colors' in the unitig metadata dict.

for n, data in g.nodes(data=True):
    for c in data['colors']:
        print("Node", n, "has color", c)

Note: By default data['colors'] iterates over all colors associated with any of the k-mers of that unitig. However, it is possible that not all k-mers share the same colors. To access the colors of a specific k-mer of the unitig use g.find() or index:

for n, data in g.nodes(data=True):
    print("Colors of first k-mer in the unitig:", set(data['colors'][0]))

Build the DNA sequence for a path through the graph:

>>> from pyfrost import Kmer, path_sequence, path_nucleotide_length

# Three nodes: ACTGATTTCGA, TCGAT, CGATGC
>>> path_sequence(g, [Kmer('ACTGA'), Kmer('TCGAT'), Kmer('CGATG')])
ACTGATTTCGATGC
>>> path_nucleotide_length(g, [Kmer('ACTGA'), Kmer('TCGAT'), Kmer('CGATG')])
14

K-mer counter

Pyfrost includes a separate k-mer counter. It's still pretty unoptimzed and slow though, but it works.

>>> from pyfrost import KmerCounter
>>> counter = KmerCounter(31).count_kmers("ACTGCTAGCTAGCTACGTACGTACGATCGTACATGCATGC")
>>> counter["ACTGCTAGCTAGCTACGTACGTACGATCGT"]
1

# You can k-merize (gzipped) FASTA/FASTQ files directly
>>> counter = KmerCounter(31).count_kmers_files(["data/sample1.fq.gz", "data/sample.2.fq.gz"])

# Save counts for later use
>>> counter.save("sampe.counts")

# Load k-mer counts
>>> counter = KmerCounter.from_file("sample.counts")

Changelog

Pyfrost is still under development and API is still subject to change.

  • 2020-10-25 - v0.1 beta 1
    • Support for loading/building Bifrost graphs
    • NetworkX-like API for accessing nodes/edges/node data
    • Support for user data per unitig
    • Support for many builtin NetworkX algorithms (DFS, BFS, ...)

About

Python bindings for Bifrost's compacted colored de Bruijn Graph with a NetworkX-compatible API

Resources

License

Code of conduct

Stars

Watchers

Forks

Packages

No packages published

Languages